Description
Material provided: data
Unit definition: Amplicon Based Sequencing
Library Preparation: 16S Metagenomic Sequencing Library Preparation
24 million reads for 2×250 Paired End Length
Short Description: Amplicon sequencing is a highly targeted approach for analysing genetic variation in specific genomic regions. The ultra-deep sequencing of PCR products (amplicons) allows efficient variant identification and characterization. Illumina amplicon technology uses a pair of oligonucleotide probes designed to target and capture regions of interest, followed by next-generation sequencing (NGS).
Amplicon sequencing is useful for the discovery of rare somatic mutations in complex samples.
Advantages:
- Offers efficiency for discovering, validating, and screening genetic variants using a highly targeted approach
- Multiplexes hundreds to over a thousand amplicons per reaction to achieve high coverage
- Delivers highly targeted resequencing even in difficult-to-sequence areas, such as GC-rich regions
- Allows flexibility for a wide range of experimental designs
- Reduces sequencing costs and turnaround time compared to broader approaches
The Experiment and the Product
Amplicon Based Sequencing, using 16S Metagenomic Sequencing Library Preparation chemicals including the following for each sample:
- PCR Amplification of custom amplicons as specified from the customer design
- Clean-Up of PCR amplicons
- Index PCR
- Clean-up of amplicon libraries
- Normalization and library pooling for MiSeq Sequencing
- Sequencing: 2 x 250 PE using MiSeq Reagent Kit v2
End-user responsibilities
Biological material will be provided by the end-users and described in the dedicated request form.
DNA input recommendations
Illumina library preparation protocol is followed by the service provider for preparing genomic DNA libraries.
Input Material to provide:
The kit protocol is optimized for 10-25 ng/µl of input gDNA total with an absorbance ratio values of 1.8 – 2.0.
Option 1 “PCR products amplified with Illumina adapters – NOT PURIFIED”:
– Agarose Gel image of the PCR products
– 5ng/ul for each PCR product. Minimal volume of 20 ml/molecular grade water.
Option 2 “PCR products amplified with Illumina adapters – PURIFIED:
– Agarose Gel image of the PCR products
– 5ng/μl for each purified PCR product. Minimal volume of 20 μl/molecular grade water
NOTE:
The Illumina overhang adapter sequences to be added to locus‐specific sequences are:
– Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locus specific sequence]
– Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus specific sequence]
REMARKS:
– if the provided sample doesn’t comply with the above requested specifications for “DNA input recommendations”, the customer will be contacted for a re-sampling.
– in case of failure of the sequencing run, the service will be repeated.
Dispatch of samples
- Safe-lock 1.5 – 2 ml tubes properly capped to be used to avoid accidental evaporation or sample contamination during shipping.
- Samples to be labelled correctly.
- Correct temperature must be ensured during the shipment to avoid sample degradation.
- Complete the enclosed Sample Submission form and return together with the samples to: orders@pologgb.com.
Supplier responsibilities:
Storage of biological sample
Polo d’Innovazione Genomica Genetica Biologia will store the analysed samples only for 1 month after delivery. Extended storage time is available for a maximum of 4 months and must be requested in advance of the experiments in the service request application.
Storage of data
Polo d’Innovazione Genomica Genetica Biologia waives any responsibility for the storage and backup of the supplied project and sequencing data after delivery to the end-user. Polo d’Innovazione Genomica Genetica Biologia will store the project data only for 1 month after delivery. After expiration of this period, all data are removed from our servers and archived (unless otherwise agreed with the end-user). Your data might be re-imported at an extra cost within the period of 1 year after delivery of the final data. After 1 year, all project data will be deleted permanently from our systems. Extended data storage is available on request at an extra cost and must be requested at project start.
Delivery of results
Sequencing results will be sent according to the Modalities of Transfer, with a QC Report PDF File 90 days upon samples delivery by the User.
Modalities of transfer:
-
- by “WeTransfer” platform for data of up to 2Gb
- by “MegaSync” platform for data ranging from 2Gb to 15Gb
- by HD for data over 15 Gb
For further details on the description of the experiment please consult the “16S Metagenomic Sequencing Library Preparation”
For more information, please contact us.
For technical assistance, contact Polo GGB Technical Support:
Email: techsupport@pologgb.com
Telephone: 0039 0577 381310
