Amplicon DNA Illumina sequencing with bioinformatics analysis

0.00

The assembly and the single nucleotide variations analysis are performed using specific pieces by amplicons. …

SKU: S.1.2A.IT.149.41 &S.1.7A.IT.149.45 Category: Tags: ,

Description

Material provided: data
Unit definition:
Amplicon Based Sequencing:
Library Preparation: 16S Metagenomic Sequencing Library Preparation
24 million reads for 2×250 Paired End Length
Short Description: The assembly and the single nucleotide variations analysis are performed using specific pieces by amplicons.

Amplicon sequencing is a highly targeted approach for analysing genetic variation in specific genomic regions. The ultra-deep sequencing of PCR products (amplicons) allows efficient variant identification and characterization. Illumina amplicon technology uses a pair of oligonucleotide probes designed to target and capture regions of interest, followed by next-generation sequencing (NGS).

Amplicon sequencing is useful for the discovery of rare somatic mutations in complex samples.

Benefits:

  • Offers efficiency for discovering, validating, and screening genetic variants using a highly targeted approach
  • Multiplexes hundreds to over a thousand amplicons per reaction to achieve high coverage
  • Delivers highly targeted resequencing even in difficult-to-sequence areas, such as GC-rich regions
  • Allows flexibility for a wide range of experimental designs
  • Reduces sequencing costs and turnaround time compared to broader approaches

The bioinformatics service includes data quality control, alignment with reference genome, statistics of sequencing depth and coverage, SNP/InDel/SV/CNV calling, annotation and statistics, functional annotation of candidate genes, pathway enrichment analysis, population genetics analysis, and so on.

Applications:

  • Identification of functional genes, biomarkers
  • Detection of genome-wide genetic variants
  • Associate DNA variants with a trait
  • Comparative analysis at the genomic level

 

The Experiment and the Product

Amplicon Based Sequencing, using Metagenomic Sequencing Library Preparation chemicals including the following for each sample:

  • PCR Amplification of custom amplicons as specified from the customer design
  • Clean-Up of PCR amplicons
  • Index PCR
  • Clean-up of amplicon libraries
  • Normalization and library pooling for MiSeq Sequencing
  • Sequencing: 2 x 250 PE using MiSeq Reagent Kit v2

The bioinformatic analysis of Illumina reads will be achieved using two different approaches based on whether a reference genome is available or not.

Reference-based assembly:

  • QC and pre-processing procedures including trimming of low-quality bases and technical sequences;
  • Alignment of reads to a reference genome
  • Variant calling, structural and functional annotations (when requested based on the research project);
  • Reconstruction of the genome consensus sequence (when requested based on the research project);
  • Population genomics analysis (when requested based on the research project).

De novo assembly:

  • Quality check and filtering of raw reads;
  • De novo genome assembly and quality control;
  • Structural and functional annotation.

The bioinformatics service includes data quality control, alignment with reference genome, statistics of sequencing depth and coverage, SNP/InDel/SV/CNV calling, annotation and statistics, functional annotation of candidate genes, pathway enrichment analysis, population genetics analysis, and so on.

 

End-user responsibilities

Biological material to be provided by the end-users and described in the dedicated request form.

DNA INPUT RECOMMENDATIONS Illumina library preparation protocol is followed by the service provider for preparing genomic DNA libraries.

 
Amplicon Sequencing:
The kit protocol is optimized for 10-25 ng/µl of input gDNA total with absorbance ratio values of 1.8 – 2.0.

Material to provide

Option 1 “PCR products amplified with Illumina adapters – NOT PURIFIED”:

  • Agarose Gel image of the PCR products;
  • 5ng/ul for each PCR product. Minimal volume of 20 ml/molecular grade water.

Option 2 “PCR products amplified with Illumina adapters – PURIFIED”:

  • Agarose Gel image of the PCR products;
  • 5ng/ul for each purified PCR product. Minimal volume of 20 ml/molecular grade water.

NOTE:
The Illumina overhang adapter sequences to be added to locus‐specific sequences are:
Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locus specific sequence]
Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus specific sequence]

– REMARKS:

  • if the provided sample doesn’t comply with the above requested specifications for “DNA INPUT RECOMMENDATIONS”, the customer will be contacted for a re-sampling.
  • in case of failure of the sequencing run, the service will be repeated.

– DESPATCH OF SAMPLES

  • Safe-lock 1.5 – 2 ml tubes properly capped to be used to avoid accidental evaporation or sample contamination during shipping.
  • Samples to be labelled correctly.
  • Correct temperature must be ensured during the shipment to avoid sample degradation.
  • Complete the enclosed Sample Submission form and return together with the samples to: orders@pologgb.com.

 

Supplier responsibilities

– STORAGE OF BIOLOGICAL SAMPLE

Polo d’Innovazione Genomica Genetica Biologia will store the analysed samples only for 1 month after delivery. Extended storage time is available for a maximum of 4 months and must be requested in advance of the experiments in the service request application.

– STORAGE OF DATA

Polo d’Innovazione Genomica Genetica Biologia waives any responsibility for the storage and backup of the supplied project and sequencing data after delivery to the end-user. Polo d’Innovazione Genomica Genetica Biologia will store the project data only for 1 month after delivery. After expiration of this period, all data are removed from our servers and archived (unless otherwise agreed with the end-user). Your data might be re-imported at an extra cost within the period of 1 year after delivery of the final data. After 1 year, all project data will be deleted permanently from our systems. Extended data storage is available on request at an extra cost and must be requested at project start.

– Delivery of results

The sequencing and bioinformatics results will be sent according to the Modalities of Transfer with a QC Library & Bioinformatic Reports PDF Files. The bioinformatic analysis will be executed in 60 working days from the generated sequencing data.

Modalities of transfer:

  • by “WeTransfer” platform to email for data of up to 2Gb
  • by “MegaSync” platform for data ranging from 2Gb to 15Gb
  • by HD for data over 15 Gb

Please note that the cost of HD driver is not included. Where requested, the end-user must provide the HD.

 

For further details on the description of the experiment please consult the “16S Metagenomics Sequencing Library Prep Guide”.

For more information, please contact us.

For technical assistance, contact Polo GGB Technical Support:
Email: techsupport@pologgb.com
Telephone: 0039 0577 381310

Additional information

Provider country

Italy

Provider(s)

Polo d'Innovazione di Genomica, Genetica e Biologia (PoloGGB)

Eligibility

In order to conform to H2020 rules promoting scientific interaction between countries, if your institute is located in the provider country, you need to choose another similar product, or form a user group to request this product, Please check: http://infravec2.eu/user-groups/